Journal: iScience

Article Title: DUX4 is a multifunctional factor priming human embryonic genome activation

doi: 10.1016/j.isci.2022.104137

Figure Lengend Snippet:

Article Snippet: KHDC1P1 guide RNA5 oligo sequence 5' to 3' (Benchling sequence underlined) , GTGGAAAGGACGAAACACCG GGTGGATGTCCAATCCCCGG G TTTTAGAGCTAGAAATAG , N/A.

Techniques: Virus, Recombinant, Blocking Assay, Membrane, Transfection, Binding Assay, Filtration, Suspension, Protease Inhibitor, Lysis, Sample Prep, Purification, Labeling, Plasmid Preparation, Gene Expression, Clone Assay, Cloning, Mutagenesis, Sequencing, Expressing, Software, CRISPR, Chromatography, Microscale Thermophoresis, Embryo Culture

Journal: Turkish Journal of Biology

Article Title: Keratin 14 is a novel interaction partner of keratinocyte differentiation regulator: receptor-interacting protein kinase 4

doi: 10.3906/biy-1904-37

Figure Lengend Snippet: Interaction of RIPK4 with KRT14. RIPK4 constructs, used in interaction assays, were schematized with domains (A). HEK293T cells were transfected with indicated constructs. KRT14 was immunoprecipitated using anti-GST antibody followed by western blotting with anti-Flag and anti-GST antibodies (B, C). RIPK4 was immunoprecipitated using anti-RIPK4 in HaCaT cells. Rabbit anti-Flag antibody was used as a control. The lysate was analyzed by western blotting using anti-KRT14 and anti-RIPK4 antibodies (D). His-RIPK4 containing lysate was incubated with GST-KRT14 bounded beads and interaction was analyzed by western blotting using anti-RIPK4 and anti-GST (E). Input indicates total lysate. α represents anti. * represents nonspecific band. ** represents heavy chains of Flag (rabbit) and RIPK4 antibody, respectively.

Article Snippet: RIPK4-specific guide RNA (g-RNA), which precedes the Protospacer Adjacent Motif (PAM), 5’ NGG, was designed using Benchling and CHOP-CHOP Web software.

Techniques: Construct, Transfection, Immunoprecipitation, Western Blot, Control, Incubation

Journal: Turkish Journal of Biology

Article Title: Keratin 14 is a novel interaction partner of keratinocyte differentiation regulator: receptor-interacting protein kinase 4

doi: 10.3906/biy-1904-37

Figure Lengend Snippet: Colocalization of RIPK4 with KRT14. HeLa cells were transfected with Flag-RIPK4, Flag-K51R, or GST-KRT14 alone (A) or together (B). HaCaT cells were transfected with Flag-RIPK4 and GST-KRT14 together (C). Cells were stained with anti-KRT14 (green) and anti-Flag (red) antibodies.

Article Snippet: RIPK4-specific guide RNA (g-RNA), which precedes the Protospacer Adjacent Motif (PAM), 5’ NGG, was designed using Benchling and CHOP-CHOP Web software.

Techniques: Transfection, Staining

Journal: Turkish Journal of Biology

Article Title: Keratin 14 is a novel interaction partner of keratinocyte differentiation regulator: receptor-interacting protein kinase 4

doi: 10.3906/biy-1904-37

Figure Lengend Snippet: Effect of RIPK4 on KRT14/5 heterodimer formation. KRT5 was immunoprecipitated using anti-Flag antibody followed by western blotting with anti-Flag and anti-GST antibodies (A). KRT5 was immunoprecipitated using anti-Flag antibody from the cell lysate of KRT14 alone and KRT14/RIPK4 together with overexpressed HEK293T cells. Western blot was performed with anti-Flag, anti-GST, and anti-RIPK4 antibodies (B). KRT14 was immunoprecipitated from HaCaT and RIPK4 KO cell line using anti-KRT14 antibody (+). Mouse anti-Flag antibody was used as a control (-). Western blot was performed with anti-KRT5, anti-KRT14, and anti-RIPK4 antibodies (C). Input indicates total cell lysate. α represents anti. * represents nonspecific bands.

Article Snippet: RIPK4-specific guide RNA (g-RNA), which precedes the Protospacer Adjacent Motif (PAM), 5’ NGG, was designed using Benchling and CHOP-CHOP Web software.

Techniques: Immunoprecipitation, Western Blot, Control

Journal: Genome Biology

Article Title: SETD2 loss-of-function uniquely sensitizes cells to epigenetic targeting of NSD1-directed H3K36 methylation

doi: 10.1186/s13059-025-03483-z

Figure Lengend Snippet: Unbiased genome-wide screening identifies NSD1 as putative SL modifier in SETD2- deficient cells. A Western blot analysis of global H3K36 methylation states in isogenic SETD2 -wildtype/mutant HAP1 cells. B Schematic depiction of CRISPR/Cas9 synthetic lethal screen. C Volcano plot highlighting NSD1 as a synthetic lethal hit (SL index: − 1.76; p value = 2.67e − 06). D Gene ontology analysis of the 127 SL candidates identified in the screen reveal enrichment for factors involved in epigenetic remodeling and DNA damage/repair. E Gene-view schematic illustrating inducible deletion of Setd2 in MEFs through Cre-lox excision of exon 6. F PCR genotyping confirming tamoxifen-inducible Cre activity in the Setd2 flox/flox parental and Setd2 flox/flox ; Nsd1 −/− MEF cell lines. G Crystal violet staining of Setd2 flox/flox and Setd2 flox/flox ; Nsd1 −/− MEF cell lines following treatment with 4-OHT

Article Snippet: Individual sgRNAs for CRISPRi targeting were selected using an in silico CRISPR guide RNA selection tool (Benchling) with corresponding oligos annealed and subcloned by cohesive-end ligation into a lentiviral mU6-(sp)TRACR guide RNA vector following AarI digestion.

Techniques: Genome Wide, Western Blot, Methylation, Mutagenesis, CRISPR, Activity Assay, Staining

Journal: iScience

Article Title: DUX4 is a multifunctional factor priming human embryonic genome activation

doi: 10.1016/j.isci.2022.104137

Figure Lengend Snippet: DUX4 activates thousands of newly identified bidirectionally transcribed enhancer-like regions that are enriched for ERVL-MaLR repeats (A) Schematic of the experimental outline. hESCs carrying an inducible DUX4 -TetOn construct were doxycycline (dox) induced for 4 h. ATAC-seq and NET-CAGE were performed to identify accessible and transcribed cis -regulatory elements, respectively. (B) Venn diagram showing the number of ATAC-seq peaks in control and DUX4 -activated hESC. (C) Bar plot showing the distribution of ATAC–seq peaks in control and DUX4 -activated cells across the genome. (D) Bar plot showing the log2 ratio of ATAC–seq peaks overlapping ERVL-MaLR regions over randomly selected background regions (See ). (E and F) Global differential expression analysis of DUX4 -expressing (dox +) and control (dox -) hESCs for promoters (E) and putative enhancers (F). Log2 mean (counts per million, CPM) of four DUX4 -expressing (dox +) and four control (dox -) replicates has been shown. Orange and purple dots indicate significantly upregulated (FDR < 0.05) promoters (E) and putative enhancers (F), respectively. Black dots indicate promoters for known 4-cell stage embryo genome activation genes. White dots indicated enhancers validated using the CRISPR activation assay. Yellow dots indicate significantly downregulated (FDR < 0.05) promoters (E) and putative enhancers (F), respectively. Grey dots indicate non-significantly differentially expressed promoters (E) and putative enhancers (F). (G) Genome browser view showing the putative enhancer-like region for ZSCAN4 . The promoter for ZSCAN4 is 20.5 kb downstream of the putative enhancer. ATAC-seq signal indicates the accessibility of chromatin and NET-CAGE signal shows bidirectional transcription start sites of enhancer RNAs in dox (+) hESCs. NET-CAGE reads in red, plus strand; NET-CAGE reads in blue, minus strand. The putative enhancer also overlaps ERVL-MaLR repeat element. See also Figure S5 . (H) Bar plot showing the log2 ratio of promoters and putative enhancers overlapping ERVL-MaLR regions over randomly selected background regions. (I and J) Schematic of CRISPR dCas9 activator constructs fused with DUX4 C-terminal end (I) or VP192 (J) used in combination with guide RNA pools to activate putative enhancers. Graphs show ZSCAN4 expression level relative to non-transfected cells (n = 6 from independent cell cultures (I); n = 3 from independent cell cultures (J)). Guide RNA construct for TdT were used as negative control. Data are shown as mean ± SD and p-values were calculated using two-tailed Student’s t -test. See also Figures S1–S5 .

Article Snippet: ZSCAN4 guide RNA 4 oligo sequence 5' to 3' (Benchling sequence underlined) , GTGGAAAGGACGAAACACCG GGTGGTGCTAAACCATTCAG G TTTTAGAGCTAGAAATAG , N/A.

Techniques: Construct, Control, Quantitative Proteomics, Expressing, Activation Assay, CRISPR, Transfection, Negative Control, Two Tailed Test

Journal: iScience

Article Title: DUX4 is a multifunctional factor priming human embryonic genome activation

doi: 10.1016/j.isci.2022.104137

Figure Lengend Snippet:

Article Snippet: ZSCAN4 guide RNA 4 oligo sequence 5' to 3' (Benchling sequence underlined) , GTGGAAAGGACGAAACACCG GGTGGTGCTAAACCATTCAG G TTTTAGAGCTAGAAATAG , N/A.

Techniques: Virus, Recombinant, Blocking Assay, Membrane, Transfection, Binding Assay, Filtration, Suspension, Protease Inhibitor, Lysis, Sample Prep, Purification, Labeling, Plasmid Preparation, Gene Expression, Clone Assay, Cloning, Mutagenesis, Sequencing, Expressing, Software, CRISPR, Chromatography, Microscale Thermophoresis, Embryo Culture